February 2019, Volume 69, Issue 2

Short Communication

Association of SNP in JPH1 gene with severity of disease in Charcot Marie Tooth 2K patients

Sumaira Kanwal  ( Department of Biosciences, COMSATS CIIT Sahiwal Campus )
Shazia Perveen  ( Department of Zoology, The Women University Multan )

Abstract

Phenotype varies among the various types of Charcot Marie Tooth Neuropathies(CMT), However the problem arises in cases of same gene but gives a huge variety of
phenotype in terms of early and late onset and severity of the disease. To check the impact of rs139723190 SNP on severity of the CMT 2k patients; being a genetic modifier of GDAP1. In the current study CMT 2k patients with early and late onset were analyzed for association of rs139723190 SNP in JPH1 gene responsible for CMT type severe and mild phenotypes. Single nucleotide polymorphisms (SNPs) lead to genetic differences in CMT patients on the basis of severity of the disease. The results of the present study suggest that variants of JPH1 may contribute to the genetic susceptibility as it plays a vital role as genetic modifier in CMT 2K. Candidates risk variants should be further evaluated in studies with a larger sample size.
Keywords: Genetic Modifier, CMT2K, axonal CMT, MAF, HMSN.

Introduction

Charcot Marie Tooth (CMT) hereditary neuropathies are a cluster of turmoil distinguished by malfunction of peripheral motor and sensory nerves. Medical attributes of CMT comprise continuous distal muscle flaw and degeneration, gentle to modest distal sensory failure, depressed tendon reflexes, and a distinctive foot
distortion with pes cavus and hammer toes. Phenotype varies among the various types of CMT, However the problem arises in cases of same gene but gives a huge variety of phenotype in terms of early and late onset and severity of the disease. As this is a well established fact that JPH1 is a genetic modifier for the Charcot-Marie- Tooth disease 2k. To find the association of a JPH1 SNP (rs139723190) with GDAP1 phenotype, seven CMT patients having GDAP1 mutations were selected. Junctional composites linking the plasma membrane and endoplasmic reticulum are a familiar trait of all impulsive cell types and mediate cross talk between cell exterior and intracellular ion channels.1 Junctophilin (JP) can be further divided into subtypes, namely JP-1, 2, and 3, have been recognized in excitable cells and comprise a new family of junctional membrane complex proteins. Recent investigations have suggested that JPs take part in the formation of junctional membrane complexes by straddling the membrane of the intracellular Ca2+ store and intermingle with the cell-surface membrane.2 Cell signaling mechanisms often transmit information via posttranslational protein modifications, most importantly reversible protein phosphorylation.3 The junctophilins have come into sight as a family of proteins that play av ita l role in c ommun ic ati on, matu rati on and maintenance of the ultrastructure's of the cell., junctophilin 1 and junctophilin 2 plays these roles Within skeletal and cardiac muscle, respectively, couple sarcolemmal and intracellular calcium channels.4 JPs dominantly affect Ca2+ signaling in striated muscle, and that's why they can be responsible for various disorders related to muscles.5 Charcot-Marie-Tooth disease (CMT) disease takes account of a inherited diverse group of inherited neuropathies, as well as recognized hereditary motor and sensory neuropathies (HMSN).6,7 Alterations in the GDAP1 gene sequences leads to various phenotypes of Charcot- Marie-Tooth (CMT ) disease, and the main medical appearance of this disease is noticeably changeable in the dominant inheritance form (CMT type 2K; CMT2K), in which transporter of the GDAP1 p.R120W mutation can exhibit a wide range of clinical brutality. It was explored the JPH1 gene as a genetic modifier of clinical expression inconsistency because junctophilin-1 (JPH1) is a good positional and functional candidate.8 GDAP1 is mainly articulated in neurons,9 whereas JPH1 is predominantly expressed in skeletal muscle.10 Autosomal recessive axonal Charcot-Marie-Tooth disease type 2K is caused by homozygous or compound heterozygous mutation in the GDAP1 gene (606598) on chromosome 8q. In human neural crest cells, it was investigated that  JPH1 primarily co localizes with markers in the endoplasmic reticulum (ER) and partially co localizes with mitochondria in the same region as GDAP1.8

Materials and Methods

Samples: CMT 2K is caused by alteration in GDAP1 gene primarily however it shows a variety of phenotypes among CMT 2K patients. The study was undertakes to  check the impact of rs139723190 SNP on severity of the CMT 2k patients; a genetic modifier of GDAP. The MAF for the current SNp is very low so it can be involved as a pathogenic as well as genetic modifier. In the current study seen CMT 2k patients with  early and late onset were analyzed for association of rs139723190 SNP in JPH1 gene responsible for CMT type severe and mild phenotypes.



Table: DNA extraction and PCR: Blood samples were collected from the patients. Written informed consent was sought from all caregivers of enrolled children. Genomic DNA was purified from peripheral blood using a QIAamp blood DNA purification kit (Qiagen, Germany). All patient samples were prescreened for the 17p12 (PMP22) duplication, which is the most frequent genetic cause of demyelinating CMT, using a hexaplex microsatellite
PCR. The present study was started in September 2016 and was finished in April 2017.11 Capillary sequencing was the technique in this study. DNA extraction was carried out from blood lymphocytes using salting out protocol with proteinase k (Garner, 2000). The primer set used for rs139723190 amplification was: forward 5'- GGCCAGAGTACTTGGACTGG -3' and reverse, 5'- ACACAGCCACTCTCCTGCTT -3'. Polymerase chain reaction was performed for this polymorphism with the following programme: 94oC for 5min, 94oC for 30 seconds, 58oC for 30 sec, 72oC for 30 sec, 72oC for 10 sec.

Conclusion

The mutations identified in JPH1 were evaluated using online available programmers to predict whether variants are deleterious. PolyPhen classifies an amino acid substitution as probably damaging, possibly damaging, benign, or unknown. Proven predicts whether an amino acid substitution affects protein function. Single nucleotide polymorphisms (SNPs) lead to genetic differences in CMT patients on the basis of severity of the disease. A study was performed to evaluate genetic variants of JPH1 gene. The results of the present study suggest that variants of JPH1 may contribute to the genetic susceptibility as it plays a vital role as genetic modifier in CMT 2K. In current study the SNP rs139723190 did not showed any association with the early and late onset CMT type 2K patients as the alleles were present in all the patients of type 2K. However due to the limited number of samples we can suggest that large number
of samples are required to establish the fact. As the JPH1 gene mutations are responsible for the CMT 4A and 2B2 so the given SNP is also a pathogenic and can be
responsible for the disease as it was also evaluated by the Phyre2 and SIFT analysis. A large number of sample are therefore needed from various ethnic origin for further studies.

Disclaimer: None
Conflict of Interest: None
Funding Sources: None

References


1. Garbino A, van Oort RJ, Dixit SS, Landstrom AP, Ackerman MJ, Wehrens XHT. Molecular evolution of the junctophilin gene family. Physiol Genomics 2009; 37: 175-86.
2. Nishi M, Mizushima A, Nakagawara KI, Takeshima H. Characterization of Human Junctophilin Subtype Genes. Biochem Biophys Res Comm 2000; 273: 920-7.
3. Olsen JV, Blagoev B, Gnad F, Macek B, Kumar C, Mortensen P, et al. Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 2006; 127: 635-48.
4. Landstrom AP, Beavers DL, Wehrens XHT. The junctophilin family of proteins: from bench to bedside. Trends Mol Med 2014; 20: 353-62.
5. Takei D, Takeshima H. [Excitation-contraction coupling and junctional membrane structures.]. Clinical calcium. 2017; 27: 333-8.
6. Patzkó Á, Shy ME. Update on Charcot-Marie-tooth disease. Curr Neurol Neurosci Rep 2011; 11: 78-88.
7. Patzko A, Shy ME. Charcot-Marie-Tooth disease and related genetic neuropathies. Continuum (Minneap Minn) 2012; 18: 39-59.
8. Pla-Martin D, Calpena E, Lupo V, Marquez C, Rivas E, Sivera R, et al. Junctophilin-1 is a modifier gene of GDAP1-related Charcot-Marie-Tooth disease. Hum Mol Genet 2015 ; 24: 213-29.
9. Pedrola L, Espert A, Wu X, Claramunt R, Shy ME, Palau F. GDAP1, the protein causing Charcot-Marie-Tooth disease type 4A, is expressed in neurons and is associated with mitochondria. Hum Mol Genet 2005 ; 14: 1087-94.
10. Takeshima H, Komazaki S, Nishi M, Iino M, Kangawa K. Junctophilins: a novel family of junctional membrane complex proteins. Mol Cell 2000; 6: 11-22.
11. Choi BO, Kim J, Lee KL, Yu JS, Hwang JH, Chung KW. Rapid diagnosis of CMT1A duplications and HNPP deletions by multiplex microsatellite PCR. Mol Cells 2007 ; 23: 39-48.

 

Journal of the Pakistan Medical Association has agreed to receive and publish manuscripts in accordance with the principles of the following committees: